Review



aavs1 safe harbor locus  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95

    Structured Review

    Addgene inc aavs1 safe harbor locus
    Aavs1 Safe Harbor Locus, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 79 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/aavs1+safe+harbor+locus/AAVS1-TALEN-L+(Plasmid+%2359025)/pmc12017769-286-9-36
    Average 95 stars, based on 79 article reviews
    aavs1 safe harbor locus - by Bioz Stars, 2026-09
    95/100 stars

    Images

    Related Articles

    Plasmid Preparation:

    Article Title: Prediction and design of transcriptional repressor domains with large-scale mutational scans and deep learning
    Article Snippet: .. Briefly, the pEF reporter was inserted at the AAVS1 safe harbor locus by TALEN-mediated homology-directed repair to integrate the pEF reporter donor plasmid (pJT039, Addgene no. 161927). .. 1000 ng of pJT039 and 500 ng of each TALEN-L (Addgene no. 35431) and TALEN-R (Addgene no. 35432) plasmids were introduced to K562 cells via electroporation, then 1000 ng/mL puromycin antibiotic (Cayman Chemical no. 28240) was added seven days later for five days to select for stable integrations at the donor locus.

    Article Title: Genetic modifiers of somatic expansion and clinical phenotypes in Huntington’s disease reveal shared and tissue-specific effects
    Article Snippet: The entire HTT exon 1 coding sequence was amplified using UltraRun® LongRange PCR Kit (QIAGEN, 206442) with 10% DMSO using the following PCR conditions: denaturation 93°C (3 min), 35 cycles of 93°C (30 s), 61°C (15 s), 68°C (60 s), with a final extension of 72 °C (10 min), using primers with SalI cloning sites (F: CATGTACGgtcgacaccgccATGGCGACCCTGGAAAAGCTG, R: CATGTACGgtcgacTCGGTGCAGCGGCTCCTC). .. Amplicons were cloned into a plasmid for targeting the AAVS1 safe harbor locus (AAVS1-TRE3G-EGFP was a gift from Su-Chun Zhang (Addgene plasmid # 52343; http://n2t.net/addgene:52343 ; RRID:Addgene_52343)). ..

    Article Title: SFSWAP is a negative regulator of OGT intron detention and global pre-mRNA splicing
    Article Snippet: .. The reporter construct generated above was integrated into the AAVS1 safe harbor locus of HCT116 cells by TALEN mediated recombination as described before ( ). hAAVS1 1L TALEN and hAAVS1 1R TALEN were gifts from Feng Zhang (Addgene plasmid #35431 and #35432 respectively)( ). ..

    Article Title: SFSWAP is a negative regulator of OGT intron detention and global pre-mRNA splicing
    Article Snippet: .. The reporter construct generated above was integrated into the AAVS1 safe harbor locus of HCT116 cells by TALEN-mediated recombination as described before ( ). hAAVS1 1L TALEN and hAAVS1 1R TALEN were gifts from Feng Zhang (Addgene plasmid #35431 and #35432, respectively) ( ). ..

    Clone Assay:

    Article Title: Genetic modifiers of somatic expansion and clinical phenotypes in Huntington’s disease reveal shared and tissue-specific effects
    Article Snippet: The entire HTT exon 1 coding sequence was amplified using UltraRun® LongRange PCR Kit (QIAGEN, 206442) with 10% DMSO using the following PCR conditions: denaturation 93°C (3 min), 35 cycles of 93°C (30 s), 61°C (15 s), 68°C (60 s), with a final extension of 72 °C (10 min), using primers with SalI cloning sites (F: CATGTACGgtcgacaccgccATGGCGACCCTGGAAAAGCTG, R: CATGTACGgtcgacTCGGTGCAGCGGCTCCTC). .. Amplicons were cloned into a plasmid for targeting the AAVS1 safe harbor locus (AAVS1-TRE3G-EGFP was a gift from Su-Chun Zhang (Addgene plasmid # 52343; http://n2t.net/addgene:52343 ; RRID:Addgene_52343)). ..

    Article Title: An optogenetic method for the controlled release of single molecules.
    Article Snippet: For the mScarlet-CD4-PhoCl-RER construct used in stable cell generation for the UV dose–response assay, fragments encoding the TRE promoter, amplified from vector pTREtight2, and mScarletCD4-PhoCl-RER were cloned into AAVS1 Safe Harbor Targeting Knock-in HR Donor 2.0 (System Bioscience, no. GE622A-1) using NEBuilder HiFi DNA Assembly (New England Biolabs) following digestion of the vector with restriction enzymes SpeI and MluI. .. The guide RNA sequence targeting the AAVS1 safe harbor locus (gRNA sequence: ggggccactagggacaggat) was cloned into vector pSpCas9(BB)-2A-GFP PX458 (Addgene, no. 48138) using the restriction site BbsI. .. The double-stranded gRNA insert was generated via annealing of two complementary primer oligos with their respective overhangs.

    Article Title: An optogenetic method for the controlled release of single molecules
    Article Snippet: For the mScarlet-CD4-PhoCl-RER construct used in stable cell generation for the UV dose–response assay, fragments encoding the TRE promoter, amplified from vector pTREtight2, and mScarlet-CD4-PhoCl-RER were cloned into AAVS1 Safe Harbor Targeting Knock-in HR Donor 2.0 (System Bioscience, no. GE622A-1) using NEBuilder HiFi DNA Assembly (New England Biolabs) following digestion of the vector with restriction enzymes SpeI and MluI. .. The guide RNA sequence targeting the AAVS1 safe harbor locus (gRNA sequence: ggggccactagggacaggat) was cloned into vector pSpCas9(BB)-2A-GFP PX458 (Addgene, no. 48138) using the restriction site BbsI. .. The double-stranded gRNA insert was generated via annealing of two complementary primer oligos with their respective overhangs.

    Sequencing:

    Article Title: An optogenetic method for the controlled release of single molecules.
    Article Snippet: For the mScarlet-CD4-PhoCl-RER construct used in stable cell generation for the UV dose–response assay, fragments encoding the TRE promoter, amplified from vector pTREtight2, and mScarletCD4-PhoCl-RER were cloned into AAVS1 Safe Harbor Targeting Knock-in HR Donor 2.0 (System Bioscience, no. GE622A-1) using NEBuilder HiFi DNA Assembly (New England Biolabs) following digestion of the vector with restriction enzymes SpeI and MluI. .. The guide RNA sequence targeting the AAVS1 safe harbor locus (gRNA sequence: ggggccactagggacaggat) was cloned into vector pSpCas9(BB)-2A-GFP PX458 (Addgene, no. 48138) using the restriction site BbsI. .. The double-stranded gRNA insert was generated via annealing of two complementary primer oligos with their respective overhangs.

    Article Title: An optogenetic method for the controlled release of single molecules
    Article Snippet: For the mScarlet-CD4-PhoCl-RER construct used in stable cell generation for the UV dose–response assay, fragments encoding the TRE promoter, amplified from vector pTREtight2, and mScarlet-CD4-PhoCl-RER were cloned into AAVS1 Safe Harbor Targeting Knock-in HR Donor 2.0 (System Bioscience, no. GE622A-1) using NEBuilder HiFi DNA Assembly (New England Biolabs) following digestion of the vector with restriction enzymes SpeI and MluI. .. The guide RNA sequence targeting the AAVS1 safe harbor locus (gRNA sequence: ggggccactagggacaggat) was cloned into vector pSpCas9(BB)-2A-GFP PX458 (Addgene, no. 48138) using the restriction site BbsI. .. The double-stranded gRNA insert was generated via annealing of two complementary primer oligos with their respective overhangs.

    Construct:

    Article Title: SFSWAP is a negative regulator of OGT intron detention and global pre-mRNA splicing
    Article Snippet: .. The reporter construct generated above was integrated into the AAVS1 safe harbor locus of HCT116 cells by TALEN mediated recombination as described before ( ). hAAVS1 1L TALEN and hAAVS1 1R TALEN were gifts from Feng Zhang (Addgene plasmid #35431 and #35432 respectively)( ). ..

    Article Title: SFSWAP is a negative regulator of OGT intron detention and global pre-mRNA splicing
    Article Snippet: .. The reporter construct generated above was integrated into the AAVS1 safe harbor locus of HCT116 cells by TALEN-mediated recombination as described before ( ). hAAVS1 1L TALEN and hAAVS1 1R TALEN were gifts from Feng Zhang (Addgene plasmid #35431 and #35432, respectively) ( ). ..

    Generated:

    Article Title: SFSWAP is a negative regulator of OGT intron detention and global pre-mRNA splicing
    Article Snippet: .. The reporter construct generated above was integrated into the AAVS1 safe harbor locus of HCT116 cells by TALEN mediated recombination as described before ( ). hAAVS1 1L TALEN and hAAVS1 1R TALEN were gifts from Feng Zhang (Addgene plasmid #35431 and #35432 respectively)( ). ..

    Article Title: SFSWAP is a negative regulator of OGT intron detention and global pre-mRNA splicing
    Article Snippet: .. The reporter construct generated above was integrated into the AAVS1 safe harbor locus of HCT116 cells by TALEN-mediated recombination as described before ( ). hAAVS1 1L TALEN and hAAVS1 1R TALEN were gifts from Feng Zhang (Addgene plasmid #35431 and #35432, respectively) ( ). ..

    Zinc-Fingers:

    Article Title: Telomeric DNA breaks in human induced pluripotent stem cells trigger ATR-mediated arrest and telomerase-independent telomere damage repair.
    Article Snippet: DD-ER-TRF1-FokI (lacking the mCherry sequence present in the original construct) was PCR amplified and Gibson cloned into Addgene plasmid #22074 downstream of the TRE promoter in place of the EGFP reporter. .. For targeted integration of rtTA and DD-ER-TRF1-FokI into the AAVS1 safe harbor locus, vectors encoding a pair of AAVS1-specific zinc finger nucleases (AAVS1-ZFN-L and AAVS1-ZFN-R) and an AAVS1 Neo-CAG-rtTA donor template were obtained from Addgene (plasmids #60915, #60916, and #60431). ..



    Similar Products

    94
    Genecopoeia aavs1 safe harbor locus
    Aavs1 Safe Harbor Locus, supplied by Genecopoeia, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/aavs1+safe+harbor+locus/Human+cell+line+HEK293T+stably+expressing+CRISPR+Cas9%2C+AAVS1+inserted%2C+single+clone/pm41174277-465-11-15
    Average 94 stars, based on 1 article reviews
    aavs1 safe harbor locus - by Bioz Stars, 2026-09
    94/100 stars
      Buy from Supplier

    99
    New England Biolabs aavs1 safe harbor locus
    Aavs1 Safe Harbor Locus, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/aavs1+safe+harbor+locus/NEBuilder+HiFi+DNA+Assembly+Master+Mix/pm39708115-89-14-24
    Average 99 stars, based on 1 article reviews
    aavs1 safe harbor locus - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    95
    Addgene inc aavs1 safe harbor locus
    Aavs1 Safe Harbor Locus, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/aavs1+safe+harbor+locus/AAVS1-TALEN-L+(Plasmid+%2359025)/pmc12017769-286-9-36
    Average 95 stars, based on 1 article reviews
    aavs1 safe harbor locus - by Bioz Stars, 2026-09
    95/100 stars
      Buy from Supplier

    90
    Synthego Inc customized sgrna targeting the human aavs1 safe harbor locus
    Customized Sgrna Targeting The Human Aavs1 Safe Harbor Locus, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/aavs1+safe+harbor+locus/aavs1+guide+rna/pm40239646-813-8-28
    Average 90 stars, based on 1 article reviews
    customized sgrna targeting the human aavs1 safe harbor locus - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    Image Search Results